19a15-1, 19a15-1 (genetic_marker) Vicia faba

Name	19a15-1
Genbank ID	tc206234
Type	CAPS
Species	Vicia faba
Primer 1	19a15-1.Forward primer: ACTTCGCATGATTGTTGATGG
Primer 2	19a15-1.Reverse Primer: ATACCCATCAGCTGCTGCTC
Restriction Enzyme	MboII
Publication	[view all]

Database	Accession
DB:genbank	tc206234

Year	Publication
2008	Ellwood SR, Phan HT, Jordan M, Hane J, Torres AM, Avila CM, Cruz-Izquierdo S, Oliver RP. Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC genomics. 2008; 9:380.