|
|
Marker Overview
| Name | AATC |
|---|
| Genbank ID | N/A |
|---|
| Type | genetic marker |
|---|
| Species | Vicia faba |
|---|
| Primer 1 | AATC.Forward Primer: TGCTTCACGATGCCACCAA |
|---|
| Primer 2 | AATC.Reverse Primer: TCCGACATTAGGATCAAGTAGG |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 2010 | Díaz-Ruiz R, Torres AM, Satovic Z, Gutierrez MV, Cubero JI, Román B. Validation of QTLs for Orobanche crenata resistance in faba bean (Vicia faba L.) across environments and generations. Theoretical and applied genetics TAG. 2010; 120(5):909-919. |
| 2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
|
