Lup337, Lup337 (genetic_marker) Vicia faba | PulseDB

Marker Overview

Marker Overview


Name	Lup337
Genbank ID	CA411368
Type	CAPS
Species	Vicia faba
Primer 1	Lup337.Forward primer: aagaaactgttacacttggtcc
Primer 2	Lup337.Reverse Primer: atagcagcataaggagatgact
Restriction Enzyme	AseI
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CA411368

Publications


Year	Publication
2008	Ellwood SR, Phan HT, Jordan M, Hane J, Torres AM, Avila CM, Cruz-Izquierdo S, Oliver RP. Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC genomics. 2008; 9:380.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-ConsensusMap_2013-RIL	LGVI	N/A	188.21	Lup337	View
2	Lupin-Kiev_Mutant/P27174-RIL-2013	LG06	N/A	61.9	Lup337	View
3	Lupin-Kiev_Mutant/P27174-RIL-2019	LG12	N/A	89.12	Lup337	View