PBA_VF_0073, PBA_VF_0073 (genetic_marker) Vicia faba | PulseDB

Marker Overview

Marker Overview


Name	PBA_VF_0073
Genbank ID	N/A
Type	EST-SSR
Species	Vicia faba
Repeat Motif	(GGT)3
Primer 1	PBA_VF_0073.Forward Primer: CCTTTGTTGTAGTCAATACGG
Primer 2	PBA_VF_0073.Reverse Primer: CATTAGAAGCACTTTCACCAC
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr5	chromosome	chr5:1284941279..1284941412 .

Publications


Year	Publication
2012	Kaur S, Pembleton LW, Cogan NO, Savin KW, Leonforte T, Paull J, Materne M, Forster JW. Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers. BMC genomics. 2012; 13:104.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-Icarus_x_Ascot-RIL-2017	Chr-V.1	N/A	126.7	PBA_VF_0073	View
2	faba-IcarusxAscot-RIL	Chr-V.1	N/A	5	PBA_VF_0073	View
3	Faba-CAB_composite_map-2019	LG05	N/A	155.54	PBA_VF_0073	View
4	Faba-CAB_integrated_map-2019	LG05	N/A	155.13	PBA_VF_0073	View
5	Faba-Icarus/Ascot-RIL-2019	LG05-2	N/A	125	PBA_VF_0073	View