PBA_VF_0280, PBA_VF_0280 (genetic_marker) Vicia faba | PulseDB

Marker Overview

Marker Overview


Name	PBA_VF_0280
Genbank ID	N/A
Type	EST-SSR
Species	Vicia faba
Repeat Motif	(CTA)3
Primer 1	PBA_VF_0280.Forward Primer: GACCTTCTTGGCACTTCTAAA
Primer 2	PBA_VF_0280.Reverse Primer: TGAGTCTGTCTCTTCTCTCCA
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr5	chromosome	chr5:4325820..4325967 .	Vicia faba inbred line Hedin/2 genome v1.0	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Kaur S, Pembleton LW, Cogan NO, Savin KW, Leonforte T, Paull J, Materne M, Forster JW. Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers. BMC genomics. 2012; 13:104.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-IcarusxAscot-RIL	Chr-V.2	N/A	62.2	PBA_VF_0280	View
2	Faba-CAB_composite_map-2019	LG05	N/A	0	PBA_VF_0280	View
3	Faba-CAB_integrated_map-2019	LG05	N/A	0	PBA_VF_0280	View
4	Faba-Icarus/Ascot-RIL-2019	LG05-3	N/A	0	PBA_VF_0280	View