VfG69, VfG69 (genetic_marker) Vicia faba

Name	VfG69
Genbank ID	N/A
Type	SSR
Species	Vicia faba
Repeat Motif	(AG)9
Primer 1	VfG69.Forward Primer: ATTGGGGAGGATGAAGGTT
Primer 2	VfG69.Reverse Primer: TTCCATTTTCCGTTCTCTCT
Product Length	195
Publication	[view all]
Contact	A.M. Torres

Name	Details
A.M. Torres	First name: A. Last name: Torres Title: Researcher Institution: Departamento de Mejora y AgronomiHa Address: C.I.F.A., Departamento de Mejora y AgronomiHa, Aptdo. 3092, E-14080 CoHrdoba, Spain Country: Spain Email: ge1toroa@uco.es Fax: 34-957-202721

Year	Publication
2009	Zeid M, Mitchell S, Link W, Carter M, Nawar A, Fulton T, Kresovich S. Simple sequence repeats (SSRs) in faba bean: new loci from Orobanche-resistant cultivar 'Giza 402'. Plant breeding. 2009; 128(2):149-155.
2017	Ocaña-Moral S, Gutiérrez N, Torres AM, Madrid E. Saturation mapping of regions determining resistance to Ascochyta blight and broomrape in faba bean using transcriptome-based SNP genotyping. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2017 Aug 08.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-29H_x_Vf136-RIL-2017	LG3	N/A	190.1	VfG69	View
2	faba-ConsensusMap_2013-RIL	LGV	N/A	209.68	VfG69	View
3	Faba-29H_x_Vf136-RIL-2021	CHR5	N/A	331.2	VfG69	View