AC123571, AC123571 (genetic_marker) Lens culinaris

Name	AC123571
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Primer 1	AC123571.Forward primer: CTGATCCTTTCCAAGAAGCG
Primer 2	AC123571.Reverse primer: CGCTAATTGCTGGCTTCAAA
Product Length	190
Publication	[view all]
Contact	Dorin Gupta

Name	Details
Dorin Gupta	First name: Dorin Last name: Gupta Institution: Pradesh Agricultural University Address: Department of Crop Improvement, CSK Himachal, Pradesh Agricultural University, Palampur, Himachal Pradesh, India Country: India Email: gupta.dorin@gmail.com Last update: Aug 2021

Year	Publication
2012	Gupta D, Taylor P, Inder P, Phan H, Ellwood S, Mathur P, Sarker A, Ford R. Integration of EST-SSR markers of Medicago truncatula into intraspecific linkage map of lentil and identification of QTL conferring resistance to ascochyta blight at seedling and pod stages. Molecular Breeding 2012 30(1):429-439

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-ILL5588xILL5722-F5-RIL-2012	LGV	N/A	17.1	AC571	View