AC149127a, AC149127a (genetic_marker) Lens culinaris | PulseDB

Marker Overview

Marker Overview


Name	AC149127a
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Primer 1	AC149127a.Forward primer: GGCTGATTTGAAACATGCCA
Primer 2	AC149127a.Reverse primer: GGTGGTTGTGGGACACTTTT
Product Length	330
Publication	[view all]
Contact	Dorin Gupta

Contact

Name

Details

Dorin Gupta

First name:	Dorin
Last name:	Gupta
Institution:	Pradesh Agricultural University
Address:	Department of Crop Improvement, CSK Himachal, Pradesh Agricultural University, Palampur, Himachal Pradesh, India
Country:	India
Email:	gupta.dorin@gmail.com
Last update:	Aug 2021

Publications


Year	Publication
2012	Gupta D, Taylor P, Inder P, Phan H, Ellwood S, Mathur P, Sarker A, Ford R. Integration of EST-SSR markers of Medicago truncatula into intraspecific linkage map of lentil and identification of QTL conferring resistance to ascochyta blight at seedling and pod stages. Molecular Breeding 2012 30(1):429-439

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-ILL5588xILL5722-F5-RIL-2012	LGVII	N/A	75.1	AC127a	View