LcSSR397, LcSSR397 (genetic_marker) Lens culinaris

Name	LcSSR397
Genbank ID	JF768562
Type	SSR
Species	Lens culinaris
Repeat Motif	(AAAT)2…(CTTT)3…(GA)9
Primer 1	LcSSR397.Forward Primer: F; TCTCAAGGAACAAACCAGCA
Primer 2	LcSSR397.Reverse Primer: TGGGATCAAGTGATACTTTTGG
Product Length	345
Publication	[view all]
Contact	Sabhyata Bhatia

Name	Details
Sabhyata Bhatia	First name: Sabhyata Last name: Bhatia Title: Researcher Institution: National Institute of Plant Genome Research Address: Aruna Asaf Ali Marg, PO Box 10531, New Delhi 110067, India Country: India Email: sabhyata_bhatia@nipgr.res.in Phone: 91 11-26735159 Fax: 91 11-26741658 Last update: Dec 2015

Database	Accession
DB:genbank	JF768562

Year	Publication
2015	Verma P, Goyal R, Chahota RK, Sharma TR, Abdin MZ, Bhatia S. Construction of a Genetic Linkage Map and Identification of QTLs for Seed Weight and Seed Size Traits in Lentil (Lens culinaris Medik.). 2015; 10(10):e0139666.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-PrecozxL830-RIL	LG1	N/A	108.5	LcSSR397	View