Lup318, Lup318 (genetic_marker) Lens culinaris

Marker Overview
NameLup318
Genbank IDDX918517
TypeCAPS
SpeciesLens culinaris
Primer 1Lup318.Forward Primer: cctagtgattctgggattacat
Primer 2Lup318.Reverse Primer: gttgcttcaatgtcacctgtat
Restriction EnzymeHpaII
Publication[view all]
ContactSimon R. Ellwood
References
External references for this genetic_marker
DatabaseAccession
DB:genbankDX918478
DB:genbankDX918517
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerLup318.Forward PrimerLens culinarisprimer
Reverse PrimerLup318.Reverse PrimerLens culinarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Lup318Lup318Lens culinarismarker_locus


Contact
NameDetails
Simon R. Ellwood
First name:Simon
Last name:Ellwood
Institution:Australian Centre for Nectrotropic Fungal Pathogens
Address:Australian Centre for Nectrotropic Fungal Pathogens, State Agricultural Biotechnology Centre, Department of Health Sciences, Murdoch University, Perth, WA 6150, Australia
Country:Australia
Email:s.ellwood@murdoch.edu.au
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1lentil-ILL5588xILL5722-F5-RILLGIN/A170.7Lup318View
2lentil-ILL5588xILL5722-F5-RIL-2012LGIN/A30.5Lup318View