Lup335, Lup335 (genetic_marker) Lens culinaris

Name	Lup335
dbSNP ID	N/A
Type	SNP
SNP Alleles	N/A
Species	Lens culinaris
Primer 1	Lup335.Forward Primer: acatttgaagaggctcaatg
Primer 2	Lup335.Internal primer: AGGATTAACTGTGCGTTTCAAA
Primer 3	Lup335.Reverse Primer: aatatgagaatgagtgggagac
Publication	[view all]
Contact	Simon R. Ellwood

Name	Details
Simon R. Ellwood	First name: Simon Last name: Ellwood Institution: Australian Centre for Nectrotropic Fungal Pathogens Address: Australian Centre for Nectrotropic Fungal Pathogens, State Agricultural Biotechnology Centre, Department of Health Sciences, Murdoch University, Perth, WA 6150, Australia Country: Australia Email: s.ellwood@murdoch.edu.au

Database	Accession
DB:genbank	DX918464
DB:genbank	DX918516

Year	Publication
2007	Phan HT, Ellwood SR, Hane JK, Ford R, Materne M, Oliver RP. Extensive macrosynteny between Medicago truncatula and Lens culinaris ssp. culinaris. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2007 Feb; 114(3):549-58.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	lentil-ILL5588xILL5722-F5-RIL	LGV	N/A	52.6	Lup335	View
2	lentil-ILL5588xILL5722-F5-RIL-2012	LGV	N/A	90.3	Lup335	View