PBA_LC_0504, PBA_LC_0504 (genetic_marker) Lens culinaris | PulseDB

Marker Overview

Marker Overview


Name	PBA_LC_0504
Genbank ID	N/A
Type	EST-SSR
Species	Lens culinaris
Repeat Motif	TGG(5)
Primer 1	PBA_LC_0504.Forward primer: AAGATTTTGCTGAGCTTATTG
Primer 2	PBA_LC_0504.Reverse primer: CTTCTCTTCCACCTTCTTCTC
Product Length	158
Publication	[view all]
Contact	John W. Forster

Contact

Name

Details

John W. Forster

First name:	John
Last name:	Forster
Institution:	La Trobe University Research and Development Park
Address:	Bundoora, VIC 3083, Australia
Country:	Australia
Email:	john.forster@depi.vic.gov.au

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr5LG3	supercontig	chr5LG3:508408617..508408777 .	Pisum sativum Cameor genome v1a	PCD marker alignment to genome using primer sequences
Lcu.2RBY.Chr2	supercontig	Lcu.2RBY.Chr2:552076297..552076454 .	Lens culinaris CDC Redberry genome v2.0	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2011	Kaur S, Cogan NO, Pembleton LW, Shinozuka M, Savin KW, Materne M, Forster JW. Transcriptome sequencing of lentil based on second-generation technology permits large-scale unigene assembly and SSR marker discovery. BMC genomics. 2011; 12:265.