PBA_LC_1563, PBA_LC_1563 (genetic_marker) Lens culinaris | PulseDB

Marker Overview

Marker Overview


Name	PBA_LC_1563
Genbank ID	N/A
Type	EST-SSR
Species	Lens culinaris
Repeat Motif	TGG(7)
Primer 1	PBA_LC_1563.Forward primer: AGTTTAGAGGAATGAGGGAAA
Primer 2	PBA_LC_1563.Reverse primer: TCTCAGCTAGGGTTTCTTTCT
Product Length	150
Publication	[view all]
Contact	John W. Forster Dharmendra Singh

Contact

Name

Details

John W. Forster

First name:	John
Last name:	Forster
Institution:	La Trobe University Research and Development Park
Address:	Bundoora, VIC 3083, Australia
Country:	Australia
Email:	john.forster@depi.vic.gov.au

Dharmendra Singh

First name:	Dharmendra
Last name:	Singh
Title:	Researcher
Institution:	Indian Agricultural Research Institute
Address:	Division of Genetics, Indian Agricultural Research Institute, New Delhi-12, India
Country:	India
Email:	dsingh_gen@iari.res.in
Last update:	Aug 2019

Publications


Year	Publication
2011	Kaur S, Cogan NO, Pembleton LW, Shinozuka M, Savin KW, Materne M, Forster JW. Transcriptome sequencing of lentil based on second-generation technology permits large-scale unigene assembly and SSR marker discovery. BMC genomics. 2011; 12:265.
2016	SINGH D, SINGH CK, TOMAR RS, CHATURVEDI AK, SHAH D, KUMAR A, PAL M. Exploring genetic diversity for heat tolerance among lentil (Lens culinaris Medik.) genotypes of variant habitats by simple sequence repeat markers. Plant Breeding. 2016; (135)215-233.