|
Marker Overview
Name | PBA_LC_1563 |
Genbank ID | N/A |
Type | EST-SSR |
Species | Lens culinaris |
Repeat Motif | TGG(7) |
Primer 1 | PBA_LC_1563.Forward primer: AGTTTAGAGGAATGAGGGAAA |
Primer 2 | PBA_LC_1563.Reverse primer: TCTCAGCTAGGGTTTCTTTCT |
Product Length | 150 |
Publication | [view all] |
Contact | John W. Forster Dharmendra Singh
|
Publications
Year | Publication |
2011 | Kaur S, Cogan NO, Pembleton LW, Shinozuka M, Savin KW, Materne M, Forster JW. Transcriptome sequencing of lentil based on second-generation technology permits large-scale unigene assembly and SSR marker discovery. BMC genomics. 2011; 12:265. |
2016 | SINGH D, SINGH CK, TOMAR RS, CHATURVEDI AK, SHAH D, KUMAR A, PAL M. Exploring genetic diversity for heat tolerance among lentil (Lens culinaris Medik.) genotypes of variant habitats by simple sequence repeat markers. Plant Breeding. 2016; (135)215-233. |
|