SSR230, SSR230 (genetic_marker) Lens culinaris

Name	SSR230
Genbank ID	N/A
Type	SSR
Species	Lens culinaris
Repeat Motif	(CA)28(TA)8
Primer 1	SSR230.Forward Primer: CCAACAACAATTCACCATAC
Primer 2	SSR230.Reverse Primer: AACATTGTACTGAGAGGTG
Product Length	251
Publication	[view all]
Contact	Michael Baum Harsh Dikshit

Name	Details
Michael Baum	First name: Michael Last name: Baum Institution: International Centre for Agricultural Research in the Dry Areas Address: ICARDA, PO Box 5466, Aleppo, Syria Country: Syria Email: M.Baum@cgiar.org
Harsh Dikshit	First name: Harsh Last name: Dikshit Title: Researcher Institution: Indian Agricultural Research Institute Address: Division of Genetics, Indian Agricultural Research Institute, New Delhi 110012, India Country: India Email: harshgeneticsiari@gmail.com

Year	Publication
2009	Hamwieh A, Udupa SM, Sarker A, Jung C, Baum M. Development of new microsatellite markers and their application in the analysis of genetic diversity in lentils. 2009; 59(1):77-86.
2017	Singh A, Sharma V, Dikshit HK, Aski M, Kumar H, Thirunavukkarasu N, Patil BS, Kumar S, Sarker A. Association mapping unveils favorable alleles for grain iron and zinc concentrations in lentil (Lens culinaris subsp. culinaris). PloS one. 2017; 12(11):e0188296.