|
|
Marker Overview
| Name | SSR59-2 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Lens culinaris |
|---|
| Repeat Motif | (CA)19(TA)19 |
|---|
| Primer 1 | SSR59-2.Forward Primer: CCAAATACTGCAACACACCG |
|---|
| Primer 2 | SSR59-2.Reverse Primer: GTTCCCATCAGGCAGAAGG |
|---|
| Max Length | 210 |
|---|
| Publication | [view all] |
|---|
| Contact | Michael Baum
|
|---|
Publications
| Year | Publication |
|---|
| 2005 | Hamwieh A, Udupa SM, Choumane W, Sarker A, Dreyer F, Jung C, Baum M. A genetic linkage map of Lens sp. based on microsatellite and AFLP markers and the localization of fusarium vascular wilt resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(4):669-77. |
| 2015 | Mekonnen F, Mekbib F, Kumar S, Ahmed S, Sharma TR. Molecular Diversity and Population Structure of the Ethiopian Lentil (Lens Culinaris Medikus) Genotype Assessment Using SSR Markers. Journal of Crop Science and Biotechnology. 2015; 19(1):1-15. |
|
