|
|
Marker Overview
| Name | GA3 |
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Vicia faba |
|---|
| Repeat Motif | (GA)14 |
|---|
| Primer 1 | GA3.Forward Primer: TTGGGAGTTTAAGGGAAGAA |
|---|
| Primer 2 | GA3.Reverse Primer: ATCATGACCTAGCGGATGAT |
|---|
| Product Length | 192 |
|---|
| Publication | [view all] |
|---|
| Contact | Soon-Jae Kwon
|
|---|
| Comment | arbitrary primer |
|---|
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2002 | Pozarkova D, Koblizkova A, Roman B, Torres AM, Lucretti S, Lysak M, Dolezel J, Macas J. Development and Characterization of Microsatellite Markers from Chromosome 1-Specific DNA Libraries of Vicia faba. 2002; 45(3):337-345. |
| 2019 | Lee MK, Lyu JI, Hong MJ, Kim DG, Kim JM, Kim JB, Eom SH, Ha BK, Kwon SJ. Utility of TRAP markers to determine indel mutation frequencies induced by gamma-ray irradiation of faba bean (Vicia faba L.) seeds. International journal of radiation biology. 2019 Apr 09; 1-33. |
Sequence
>GA3 ID=GA3; Name=GA3; organism=Vicia faba; type=genetic_marker; length=20bp
TCATCTCAAACCATCTACAC
|
