PES149, PES149 (genetic_marker) Vicia faba | PulseDB

Marker Overview

Marker Overview


Name	PES149
Genbank ID	N/A
Type	EST-SSR
Species	Vicia faba
Repeat Motif	(GTG)6
Primer 1	PES149.Forward Primer: GAGGCTTCCTAAAGCCCAGT
Primer 2	PES149.Reverse Primer: CACGTGGCTTACGATTTTGA
Product Length	164
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr2LG1	supercontig	chr2LG1:70183401..70183564 .	Pisum sativum Cameor genome v1a	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2013	Ma Y, Bao S, Yang T, Hu J, Guan J, He Y, Wang XJ, Wan Y, Sun X, Jiang J, Ging C, Zong X. Genetic linkage map of Chinese native variety faba bean (Vicia faba L.) based on simple sequence repeat markers. 2013; 132(4):397-400.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-91825xK1563-F2	LG4	N/A	297	PES149	View
2	Faba-91825/K1563-F2-2019	LG04	N/A	772	PES149	View