|
Marker Overview
Name | RGA09 |
Genbank ID | N/A |
Type | RGA |
Species | Vicia faba |
Primer 1 | RGA09.Forward Primer: ATGACCGAATCTCACAACAA |
Primer 2 | RGA09.Reverse Primer: GTCATTAACCAACCATTCC |
Publication | [view all] |
Contact | A.M. Torres
|
Publications
Year | Publication |
2013 | Satovic Z, Avila CM, Cruz-Izquierdo S, Diaz-Ruiz R, Garcia-Ruiz M, Palomino C, Gutierrez N, Vitale S, Ocana-Moral S, Gutierrez MV, Cubero JI, Torres AM. A reference consensus genetic map for molecular markers and economically important traits in faba bean (Vicia faba L.). 2013; 14:932. |
2017 | Ocaña-Moral S, Gutiérrez N, Torres AM, Madrid E. Saturation mapping of regions determining resistance to Ascochyta blight and broomrape in faba bean using transcriptome-based SNP genotyping. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2017 Aug 08. |
|