|
|
Marker Overview
| Name | S33 |
|---|
| Genbank ID | GO315340 |
|---|
| Type | EST-SSR |
|---|
| Species | Lathyrus sativus |
|---|
| Repeat Motif | (TTTTG)3 |
|---|
| Primer 1 | S33.Forward Primer: TGGTTTTGTTGTGGAAAGTGAG |
|---|
| Primer 2 | S33.Reverse Primer: ACTGCAAAAGCCTCAAAGGA |
|---|
| Product Length | 200 |
|---|
| Publication | [view all] |
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | GO315340 |
Alignments
The following features are aligned
Publications
| Year | Publication |
|---|
| 2012 | Sun X-L, Yang T, Guan J-P, Ma Y, Jiang J-Y, Cao R, Burlyaeva M, Vishnyakova M, Semenova E, Bulyntzev S, Zong X-X. Development of 161 novel EST-SSR markers from Lathyrus sativus (Fabaceae). 2012; e379-e390. |
|
