SSR734, SSR734 (genetic_marker) Vicia faba | PulseDB

Marker Overview

Marker Overview


Name	SSR734
Genbank ID	N/A
Type	SSR
Species	Vicia faba
Repeat Motif	(CT)8
Primer 1	SSR734.Forward Primer: GATGGGCAAGGAAGAGTTGA
Primer 2	SSR734.Reverse Primer: CCGGCTTGTAAGACAAGGAC
Product Length	190
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold02745	supercontig	scaffold02745:72580..72708 .

Publications


Year	Publication
2013	Ma Y, Bao S, Yang T, Hu J, Guan J, He Y, Wang XJ, Wan Y, Sun X, Jiang J, Ging C, Zong X. Genetic linkage map of Chinese native variety faba bean (Vicia faba L.) based on simple sequence repeat markers. 2013; 132(4):397-400.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-91825xK1563-F2	LG1	N/A	429.1	SSR734	View
2	Faba-91825/K1563-F2-2019	LG01	N/A	960.46	SSR734	View