CID_C_10218033, CID_C_10218033 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	CID_C_10218033
Genbank ID	N/A
Type	Indel
Species	Cicer arietinum
Germplasm	ICC4958
Primer 1	CID_C_10218033.Forward Primer: TTTGCTTTTGTTTGTTTATTTATTGC
Primer 2	CID_C_10218033.Reverse Primer: TTGACCACTTGAAATTTAATCCA
Product Length	104
Publication	[view all]
Contact	Swarup Parida

Contact

Name

Details

Swarup Parida

First name:	Swarup
Last name:	Parida
Title:	Researcher
Institution:	National Institute of Plant Genome Research
Address:	NIPGR, Aruna Asaf Ali Marg, New Delhi 110067, India
Country:	India
Email:	swarup@nipgr.ac.in
Phone:	+91 11-26735228
Fax:	+91 11-26741658
Last update:	Mar 2015

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca6	chromosome	Ca6:36104512..36104613 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr6	chromosome	chr6:36104512..36104613 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2015	Das S, Upadhyaya HD, Srivastava R, Bajaj D, Gowda CL, Sharma S, Singh S, Tyagi AK, Parida SK. Genome-wide insertion-deletion (InDel) marker discovery and genotyping for genomics-assisted breeding applications in chickpea. DNA research : an international journal for rapid publication of reports on genes and genomes. 2015 Sep 17; 22(5):377-386.

Germplasm


Stock Name	Type
ICC4958	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958	Ca_LG_2	N/A	10218033	CID_C_10218033	View