CID_C_477164, CID_C_477164 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	CID_C_477164
Genbank ID	N/A
Type	Indel
Species	Cicer arietinum
Germplasm	ICC4958
Primer 1	CID_C_477164.Forward Primer: TCATTGAGAGGTATCAGGAGCA
Primer 2	CID_C_477164.Reverse Primer: TGGTGCTACTGATTTCAATGTT
Product Length	178
Publication	[view all]
Contact	Swarup Parida

Contact

Name

Details

Swarup Parida

First name:	Swarup
Last name:	Parida
Title:	Researcher
Institution:	National Institute of Plant Genome Research
Address:	NIPGR, Aruna Asaf Ali Marg, New Delhi 110067, India
Country:	India
Email:	swarup@nipgr.ac.in
Phone:	+91 11-26735228
Fax:	+91 11-26741658
Last update:	Mar 2015

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca1	chromosome	Ca1:388921..389098 .
chr1	chromosome	chr1:388921..389098 .

Publications


Year	Publication
2015	Das S, Upadhyaya HD, Srivastava R, Bajaj D, Gowda CL, Sharma S, Singh S, Tyagi AK, Parida SK. Genome-wide insertion-deletion (InDel) marker discovery and genotyping for genomics-assisted breeding applications in chickpea. DNA research : an international journal for rapid publication of reports on genes and genomes. 2015 Sep 17; 22(5):377-386.

Germplasm


Stock Name	Type
ICC4958	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958	Ca_LG_1	N/A	477164	CID_C_477164	View
2	chickpea-ICC4958xICC17160	CaLG01	N/A	6.8	CID_C_477164	View