Beta-amylase-like_3, Beta-amylase-like_3 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	Beta-amylase-like_3
Genbank ID	XM_004513491
Type	gene marker
Species	Cicer arietinum
Primer 1	Beta-amylase-like_3.Ps_1602 (S): TGCTGCTGAACTCACTGCTGGA
Primer 2	Beta-amylase-like_3.Ps_1606: TGAATCCCAAGGGAACGGCACT
Product Length	481
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	XM_004513491

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr7LG7	supercontig	chr7LG7:377592379..377593119 .

Publications


Year	Publication
2017	Carpenter MA, Shaw M, Cooper RD, Frew TJ, Butler RC, Murray SR, Moya L, Coyne CJ, Timmerman-Vaughan GM. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes. BMC plant biology. 2017 Aug 01; 17(1):132.