Cell wall invertase, Cell wall invertase (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	Cell wall invertase
Genbank ID	AF063246
Type	gene marker
Species	Pisum sativum
Primer 1	Cell wall invertase.Ps_0276 (S): TGATCCTCAACTTCTGTGTAGTC
Primer 2	Cell wall invertase.Ps_0280: TGCTAATGTAGGATAAACTCTGG
Product Length	303
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	AF063246

Publications


Year	Publication
2017	Carpenter MA, Shaw M, Cooper RD, Frew TJ, Butler RC, Murray SR, Moya L, Coyne CJ, Timmerman-Vaughan GM. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes. BMC plant biology. 2017 Aug 01; 17(1):132.