Hexokinase_2, Hexokinase_2 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	Hexokinase_2
Genbank ID	XM_003630659
Type	gene marker
Species	Pisum sativum
Primer 1	Hexokinase_2.Ps_2050 (S): AAGCGGAGTTTTTCGGAGAT
Primer 2	Hexokinase_2.Ps_2051: ACCGCGATAAGCAACAATG
Product Length	244
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	XM_003630659

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr7LG7	supercontig	chr7LG7:26283138..26283596 .

Publications


Year	Publication
2017	Carpenter MA, Shaw M, Cooper RD, Frew TJ, Butler RC, Murray SR, Moya L, Coyne CJ, Timmerman-Vaughan GM. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes. BMC plant biology. 2017 Aug 01; 17(1):132.