Invertase inhibitor, Invertase inhibitor (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	Invertase inhibitor
Genbank ID	XM_004508064
Type	gene marker
Species	Cicer arietinum
Primer 1	Invertase inhibitor.Ps_2042 (S): TTAAATGAACCCCCACCAGA
Primer 2	Invertase inhibitor.Ps_2043: TCCAGAAGCACTTTCCCATC
Product Length	411
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	XM_004508064

Publications


Year	Publication
2017	Carpenter MA, Shaw M, Cooper RD, Frew TJ, Butler RC, Murray SR, Moya L, Coyne CJ, Timmerman-Vaughan GM. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes. BMC plant biology. 2017 Aug 01; 17(1):132.