Isoamylase, isoform 3, Isoamylase, isoform 3 (genetic_marker) Pisum sativum

Marker Overview


Name	Isoamylase, isoform 3
Genbank ID	DQ092415
Type	gene marker
Species	Pisum sativum
Primer 1	Isoamylase, isoform 3.Ps_1479 (S): TGCTTCCCACACCCCCAACA
Primer 2	Isoamylase, isoform 3.Ps_1483: TCGTAGGACCACTCTCAAGTAGAGCTT
Product Length	511
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	DQ092415

Publications


Year	Publication
2017	Carpenter MA, Shaw M, Cooper RD, Frew TJ, Butler RC, Murray SR, Moya L, Coyne CJ, Timmerman-Vaughan GM. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes. BMC plant biology. 2017 Aug 01; 17(1):132.

Search form