Phosphoglucomutase (plastidial)_1, Phosphoglucomutase (plastidial)_1 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	Phosphoglucomutase (plastidial)_1
Genbank ID	AJ250770
Type	gene marker
Species	Pisum sativum
Primer 1	Phosphoglucomutase (plastidial)_1.Ps_1321 (S): GTCAACGCCAGCCGTTTC
Primer 2	Phosphoglucomutase (plastidial)_1.Ps_1322 (S): GGGTGTTTCCGTAAATCTTGTC
Product Length	471
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	AJ250770

Publications


Year	Publication
2017	Carpenter MA, Shaw M, Cooper RD, Frew TJ, Butler RC, Murray SR, Moya L, Coyne CJ, Timmerman-Vaughan GM. Association mapping of starch chain length distribution and amylose content in pea (Pisum sativum L.) using carbohydrate metabolism candidate genes. BMC plant biology. 2017 Aug 01; 17(1):132.