3835, 3835 (genetic_marker) Pisum sativum

Name	3835
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	3835.Forward: ACACGCATGCACGATTACAT
Primer 2	3835.Reverse: GCTTTGTCACGCGATGTGTA
Product Length	183
Publication	[view all]
Contact	Xuxiao Zong

This genetic_marker is adjacent to the following primer feature(s):

Feature Name	Unique Name	Species	Type
Forward	3835.Forward	Pisum sativum	primer
Reverse	3835.Reverse	Pisum sativum	primer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature Name	Unique Name	Species	Type
3835	3835-120.6	Pisum sativum	marker_locus
3835	3835	Pisum sativum	marker_locus

Year	Publication
2014	Sun X, Yang T, Hao J, Zhang X, Ford R, Jiang J, Wang F, Guan J, Zong X. SSR genetic linkage map construction of pea (Pisum sativum L.) based on Chinese native varieties. The Crop Journal. 2014; 2:170-174.

Name	Details
Xuxiao Zong	First name: Xuxiao Last name: Zong Institution: Chinese Academy of Agricultural Science Address: Institute of Crop Sciences, The National Key Facility for Crop Gene Resources and Genetic Improvement, Chinese Academy of Agricultural Sciences, Beijing 100081, China Country: China Email: zongxx@mail.caas.net.cn Last update: Mar 2014

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pea-G0003973_x_Zhongwan6-F2	LG-A	N/A	120.6	3835	View
2	Pea-G0003973_x_Zhongwan6-F2-2015	LG-A	N/A	151.5	3835	View