|
|
Marker Overview
| Name | BMc-032 |
|---|
| Genbank ID | HO212349 |
|---|
| Type | EST-SSR |
|---|
| Species | Phaseolus vulgaris |
|---|
| Repeat Motif | (GACACC)2(ACC)4 |
|---|
| Primer 1 | BMc-032.Forward: TCCTCTTCTTCAGCCCAATG |
|---|
| Primer 2 | BMc-032.Reverse: TTCCCAGCTCTTCCCAGA |
|---|
| Product Length | 140 |
|---|
| Publication | [view all] |
|---|
| Contact | Matthew Blair
|
|---|
References
External references for this genetic_marker
| Database | Accession |
|---|
| DB:genbank | HO212349 |
Publications
| Year | Publication |
|---|
| 2011 | Blair MW, Hurtado N, Chavarro CM, Muñoz-Torres MC, Giraldo MC, Pedraza F, Tomkins J, Wing R. Gene-based SSR markers for common bean (Phaseolus vulgaris L.) derived from root and leaf tissue ESTs: an integration of the BMc series. BMC plant biology. 2011 Mar 22; 11:50. |
| 2010 | Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70. |
|
