BM-152

Marker Overview
NameBM-152
Genbank IDN/A
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(GA)31
Primer 1BM-152.Forward: AAGAGGAGGTCGAAACCTTAAATCG
Primer 2BM-152.Reverse: CCGGGACTTGCCAGAAGAAC
Product Length127
Publication[view all]
ContactJ. Tohme
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ForwardBM-152.ForwardPhaseolus vulgarisprimer
ReverseBM-152.ReversePhaseolus vulgarisprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.Cerinza/G10022.LG02.da12.2Phaseolus vulgarisQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BM152BM152Phaseolus vulgarismarker_locus


Contact
NameDetails
J. Tohme
First name:J
Last name:Tohme
Institution:International Center for Tropical Agriculture
Email:j.tohme@cgiar.org
Last update:Nov 2002
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-Cerinza/G10022-BC2LG02N/A0BM152View
2Bean-Cerinza/G10022-BC2-2012LG02N/A0BM152View
3Bean-Tiber/Starozagorski-IntegratedLG02N/A43.21BM152View
4Bean-Tiber/Starozagorski-RILLG02N/A135.92BM152View