BMb-0356

Marker Overview
NameBMb-0356
Genbank IDN/A
TypeSSR
SpeciesPhaseolus vulgaris
Repeat Motif(TA)14
Primer 1BMb-356.Forward: TCCGAATTTCTTAATTTCACTT
Primer 2BMb-356.Reverse: ATCGCGGATTTATATGTGTC
Product Length187
Publication[view all]
ContactLorenzo Raggi
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
ReverseBMb-356.ReversePhaseolus vulgarisprimer
ForwardBMb-356.ForwardPhaseolus vulgarisprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
BMb356BMb356Phaseolus vulgarismarker_locus
BMb356BMb356-50.2Phaseolus vulgarismarker_locus
BMB356BMB356-48.47Phaseolus vulgarismarker_locus
BMB356BMB356-98.55Phaseolus vulgarismarker_locus
BMB356BMB356-86.69Phaseolus vulgarismarker_locus
BMb356BMb356-96.1Phaseolus vulgarismarker_locus


Contact
NameDetails
Lorenzo Raggi
First name:Lorenzo
Last name:Raggi
Institution:Universita degli Studi di Perugia
Country:Italy
Email:lorenzo.raggi@gmail.com
Last update:Feb 2017
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Bean-DOR364/G19833-RIL-2010LG01N/A0BMb356View
2Bean-Tiber/Starozagorski-IntegratedLG01N/A191.9BMb356View
3Bean-Tiber/Starozagorski-RILLG01N/A102.44BMb356View
4Bean-PMB0225/PHA1037-RILLG01-1N/A50.2BMb356View
5Bean-Beluga/PHA0399-RILLG01N/A48.47BMB356View
6Bean-Gonzalez_consensus_map-2016LG01N/A98.55BMB356View
7Bean-PHA0419/Beluga-RILLG01N/A86.69BMB356View
8Bean-PMB0225/PHA1037-RIL-2015LG01N/A96.1BMb356View