SSR-IAC068

Name	SSR-IAC068
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(CT)8
Primer 1	SSR-IAC068.Forward: TTGGAGGTAACGCTTTTTTG
Primer 2	SSR-IAC068.Reverse: ATTTAACATGAACGACCACC
Product Length	260-272
Max Length	270
Publication	[view all]
Contact	Juliana Perseguini Marta Santalla Luciana Benchimol

Name	Details
Juliana Perseguini	First name: Juliana Last name: Perseguini Institution: Instituto Agronomico de Campinas Country: Brazil Email: julianamorini@hotmail.com
Marta Santalla	First name: Marta Last name: Santalla Institution: Mision Biologica de Galicia-Consejo Superior de Investigaciones Cientificas Country: Spain Email: msantalla@mbg.csic.es Last update: Dec 2016
Luciana Benchimol	First name: Luciana Last name: Benchimol Institution: Gouvea Centro de Pesquisa e Desenvolvimento de Recursos Geneticos Vegetais Country: Brazil Email: llasry@iac.sp.gov.br Last update: Apr 2007

Year	Publication
2011	Küpper Cardoso Perseguini JM, Chioratto AF, Zucchi MI, Colombo CA, Carbonell SA, Costa Mondego JM, Gazaffi R, Franco Garcia AA, de Campos T, de Souza AP, Rubiano LB. Genetic diversity in cultivated carioca common beans based on molecular marker analysis. Genetics and molecular biology. 2011 Jan; 34(1):88-102.
2016	González AM, Yuste-Lisbona FJ, Saburido S, Bretones S, De Ron AM, Lozano R, Santalla M. Major Contribution of Flowering Time and Vegetative Growth to Plant Production in Common Bean As Deduced from a Comparative Genetic Mapping. Frontiers in plant science. 2016; 7:1940.
2007	Benchimol LL, deCampos T, Carbonell SAM, Colombo CA, Chioratto AF, Formighieri EF, Gouvea LRL, deSouza AP. Structure of genetic diversity among common bean (Phaseolus vulgaris L.) varieties of Mesoamerican and Andean origins using new developed microsatellite markers. Genet Resour Crop Evol. 2007; 54:1747-1762.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-Gonzalez_consensus_map-2016	LG09	N/A	58.62	IAC068	View