BMb-0185

Name	BMb-0185
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(AC)6
Primer 1	BMb-0185.Forward: GTCACAGCAAACCCTATCC
Primer 2	BMb-0185.Reverse: CTCCATTGACAAAGAGAGAAA
Product Length	121
Publication	[view all]
Contact	Matthew Blair

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Aligned Feature	Feature Type	Alignment Location
Chr01	supercontig	Chr01:14834870..14834990 .

Year	Publication
2014	Blair MW, Córdoba JM, Muñóz C, Yuyó DK. BAC-end microsatellites from intra and inter-genic regions of the common bean genome and their correlation with cytogenetic features. PloS one. 2014; 9(9):e101873.
2010	Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-DOR364/G19833-RIL	LG11	N/A	36.4	BMb185	View
2	Bean-DOR364/G19833-RIL-2010	LG11	N/A	61.4	BMb185	View
3	Bean-Tiber/Starozagorski-Integrated	LG11	N/A	63.24	BMb185	View