BMb-0688s | PulseDB

Marker Overview

Marker Overview


Name	BMb-0688s
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(AT)11
Primer 1	BMb-0688s.Forward: TCCTCCTTTCTCTCACAGTC
Primer 2	BMb-0688s.Reverse: AATGTGGTTGGTAAATTTGG
Product Length	265
Publication	[view all]
Contact	Matthew Blair

Contact

Name

Details

Matthew Blair

First name:	Matthew
Last name:	Blair
Institution:	International Center for Tropical Agriculture
Country:	Colombia
Email:	mwblaircgiar@gmail.com
Last update:	Aug 2009

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr07	supercontig	Chr07:20745953..20746217 .	Phaseolus vulgaris G19833 genome v2.1	PCD marker alignment to genome using primer sequences
Pl07_G27455	supercontig	Pl07_G27455:12832074..12832369 .	Phaseolus lunatus cv. G27455 genome v1.0	PCD marker alignment to genome using primer sequences
Chr07_WLD	supercontig	Chr07_WLD:13769430..13769710 .	Phaseolus acutifolius acc. W6 15578 genome v2.0	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Blair MW, Córdoba JM, Muñóz C, Yuyó DK. BAC-end microsatellites from intra and inter-genic regions of the common bean genome and their correlation with cytogenetic features. PloS one. 2014; 9(9):e101873.