BMb-0702s

Name	BMb-0702s
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(TTA)4
Primer 1	BMb-0702s.Forward: AGGAAGCATCAACCACTAGA
Primer 2	BMb-0702s.Reverse: CTGTGTGCCCGTTAGTTAAT
Product Length	191
Publication	[view all]
Contact	Matthew Blair

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Year	Publication
2014	Blair MW, Córdoba JM, Muñóz C, Yuyó DK. BAC-end microsatellites from intra and inter-genic regions of the common bean genome and their correlation with cytogenetic features. PloS one. 2014; 9(9):e101873.