BMb-0714s

Name	BMb-0714s
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(AT)30
Primer 1	BMb-0714s.Forward: CCTGTTGAATTGTTGGAGAT
Primer 2	BMb-0714s.Reverse: TTGTGTATTACAAAGGCACAC
Product Length	275
Publication	[view all]
Contact	Matthew Blair

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Feature Name	Type	Location	Analysis	Reference
Chr01	supercontig	Chr01:3974212..3974484 .	Phaseolus vulgaris G19833 genome v2.1	PCD marker alignment to genome using primer sequences
Pl01_G27455	supercontig	Pl01_G27455:4479848..4480099 .	Phaseolus lunatus cv. G27455 genome v1.0	PCD marker alignment to genome using primer sequences

Year	Publication
2014	Blair MW, Córdoba JM, Muñóz C, Yuyó DK. BAC-end microsatellites from intra and inter-genic regions of the common bean genome and their correlation with cytogenetic features. PloS one. 2014; 9(9):e101873.