BMb-1664s

Name	BMb-1664s
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(TA)5
Primer 1	BMb-1664s.Forward: GTTGAGTTACGTGCTTACTT
Primer 2	BMb-1664s.Reverse: ATAGGACAGAGGTCTTCTAAAC
Product Length	370
Publication	[view all]
Contact	Matthew Blair

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009

Feature Name	Type	Location	Analysis	Reference
Chr_9-CM003379.1	supercontig	Chr_9-CM003379.1:8298181..8298562 .	Vigna angularis Jingnong 6 genome v1.1	PCD marker alignment to genome using primer sequences
Chr11_WLD	supercontig	Chr11_WLD:23048237..23048606 .	Phaseolus acutifolius acc. W6 15578 genome v2.0	PCD marker alignment to genome using primer sequences

Year	Publication
2014	Blair MW, Córdoba JM, Muñóz C, Yuyó DK. BAC-end microsatellites from intra and inter-genic regions of the common bean genome and their correlation with cytogenetic features. PloS one. 2014; 9(9):e101873.