|
Marker Overview
Name | BM-0137 |
Genbank ID | N/A |
Type | SSR |
Species | Phaseolus vulgaris |
Repeat Motif | (CT)33 |
Primer 1 | BM-0137.Forward: CGCTTACTCACTGTACGCACG |
Primer 2 | BM-0137.Reverse: CCGTATCCGAGCACCGTAAC |
Product Length | 155 |
Publication | [view all] |
Contact | Matthew Blair J. Tohme
|
Publications
Year | Publication |
2010 | Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436. |
2010 | Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70. |
2002 | Gaitan-Solis E, Duque MC, Edwards KJ, Tohme J. Microsatellite Repeats in Common Bean (Phaseolus vulgaris): Isolation, Characterization, and Cross-Species Amplification in Phaseolus ssp.. Crop Science. 2002; 42:2128-2136. |
|