BM-0189

Name	BM-0189
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(CT)13
Primer 1	BM-0189.Forward: CTCCCACTCTCACCCTCACT
Primer 2	BM-0189.Reverse: GCGCCAAGTGAAACTAAGTAGA
Product Length	114
Publication	[view all]
Contact	Matthew Blair J. Tohme

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009
J. Tohme	First name: J Last name: Tohme Institution: International Center for Tropical Agriculture Email: j.tohme@cgiar.org Last update: Nov 2002

Aligned Feature	Feature Type	Alignment Location
Chr03	supercontig	Chr03:48506648..48506761 .
Chr03_WLD	supercontig	Chr03_WLD:38648335..38648442 .

Year	Publication
2010	Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436.
2002	Gaitan-Solis E, Duque MC, Edwards KJ, Tohme J. Microsatellite Repeats in Common Bean (Phaseolus vulgaris): Isolation, Characterization, and Cross-Species Amplification in Phaseolus ssp.. Crop Science. 2002; 42:2128-2136.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-DOR364/G19833-RIL-2010	LG08	N/A	61.1	BM189	View
2	Bean-Beluga/PHA0399-RIL	LG03	N/A	76.79	BM189	View
3	Bean-Gonzalez_consensus_map-2016	LG03	N/A	106.56	BM189	View
4	Bean-PHA0419/Beluga-RIL	LG03	N/A	95.82	BM189	View
5	Bean-PMB0225/PHA1037-RIL-2015	LG08	N/A	0	BM189	View
6	Bean-Cerinza/G10022-BC2	LG08	N/A	0	BM189	View
7	Bean-Cerinza/G10022-BC2-2012	LG08	N/A	0	BM189	View
8	Vigna-JP235863/AusTRCF66514-F2	LG01	N/A	53.6	BM189	View
9	Bean-Tiber/Starozagorski-Integrated	LG08	N/A	77.37	BM189	View
10	Bean-DOR364/G19833-RIL-2008	LG08	N/A	64	BM189	View