|
Marker Overview
Name | BMd-0052 |
Genbank ID | AF325187 |
Type | SSR |
Species | Phaseolus vulgaris |
Repeat Motif | (ATT)4 |
Primer 1 | BMd-0052.Forward: TCTTGGTGCGCAGAAAGTTA |
Primer 2 | BMd-0052.Reverse: AAGGCTTTGTTTTGATTAAGGTT |
Product Length | 151 |
Publication | [view all] |
Contact | Matthew Blair
|
Comment | precursor Putative POL3-like reverse transcriptase |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | AF325187 |
Publications
Year | Publication |
2010 | Córdoba JM, Chavarro C, Schlueter JA, Jackson SA, Blair MW. Integration of physical and genetic maps of common bean through BAC-derived microsatellite markers. BMC genomics. 2010 Jul 16; 11:436. |
2003 | Blair MW, Pedraza F, Buendia HF, Gaitán-Solís E, Beebe SE, Gepts P, Tohme J. Development of a genome-wide anchored microsatellite map for common bean (Phaseolus vulgaris L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2003 Nov; 107(8):1362-74. |
|