ATA-0020

Name	ATA-0020
Genbank ID	N/A
Type	SSR
Species	Phaseolus vulgaris
Repeat Motif	(TAA)72
Primer 1	ATA-0020.Forward: GCATTGCAGGAAATCAT
Primer 2	ATA-0020.Reverse: TGTATCAATTACTTTTTTAC
Product Length	293
Max Length	320
Publication	[view all]
Contact	Matthew Blair Matthew W. Blair

Name	Details
Matthew Blair	First name: Matthew Last name: Blair Institution: International Center for Tropical Agriculture Country: Colombia Email: mwblaircgiar@gmail.com Last update: Aug 2009
Matthew W. Blair	First name: Matthew Last name: Blair Title: Researcher Institution: Tennessee State Univ Address: Tennessee State Univ., Dep. of Agricultural and Environmental Science, Nashville, TN 37209 Country: USA Email: mblair@tnstate.edu Last update: Feb 2013

Year	Publication
2010	Blair MW, Medina JI, Astudillo C, Rengifo J, Beebe SE, Machado G, Graham R. QTL for seed iron and zinc concentration and content in a Mesoamerican common bean (Phaseolus vulgaris L.) population. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2010 Oct; 121(6):1059-70.
2008	Blair MW, Buendia HF, Giraldo MC, Metais I, Peltier D. Characterization of AT-rich microsatellites in common bean (Phaseolus vulgaris L.). Theor Appl Genet. 2008; 118:91-103.

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Bean-G14519/G4825-RIL	LG04	N/A	71.9	ATA20	View
2	Bean-DOR364/G19833-RIL-2008	LG04	N/A	147.6	ATA020	View