Transcript Overview
Name Ca_08213 Unique Name Ca_08213_v1.0_kabuli Type mRNA Organism Cicer arietinum (chickpea) Sequence length 219
Alignments
The following features are aligned
Analyses
This mRNA is derived from or has results from the following analyses
Orthologs
Syntenic blocks
Orthologs
Relationships
The following CDS feature(s) are a part of this mRNA:
Feature Name Unique Name Species Type
Ca_08213-CDS1 Ca_08213-CDS1 Cicer arietinum CDS
The following polypeptide feature(s) derives from this mRNA:
Feature Name Unique Name Species Type
Ca_08213_v1.0_kabuli Ca_08213_v1.0_kabuli Cicer arietinum polypeptide
Homology
The following BLAST results are available for this feature:
Expression
Available Analyses
Select an Expression Analysis
Expression: Chickpea drought stress response
Select a property to group and sort biological samples
Select a property to color biological samples
Hover the mouse over a column in the graph to view more information about
that biological sample.
You can click and drag to rearrange groups along the x-axis. You can also
click and drag to move the legend.
Only Non-Zero Values |
Reset
0 1,000 Expression value 0 806 1612 Expression by
Download expression dataset for this feature
InterPro
Analysis Name: InterProScan analysis for kabuli C. arietinum unigenes
Date Performed: 2013-10-24
20 40 60 80 100 120 140 160 180 200 Score = NA Sequence seg
IPR Term IPR Description Source Source Term Source Description Alignment
None No IPR available SEG seg seg coord: 20..33
Sequences
The
following sequences are available for this feature:
mRNA sequence
>Ca_08213_v1.0_kabuli ID=Ca_08213_v1.0_kabuli; Name=Ca_08213; organism=Cicer arietinum; type=mRNA; length=219bp back to top protein sequence of Ca_08213_v1.0_kabuli
>Ca_08213_v1.0_kabuli ID=Ca_08213_v1.0_kabuli; Name=Ca_08213_v1.0_kabuli; organism=Cicer arietinum; type=polypeptide; length=72bp back to top mRNA from alignment at Ca3:26929923..26930141-
Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>Ca_08213_v1.0_kabuli ID=Ca_08213_v1.0_kabuli; Name=Ca_08213; organism=Cicer arietinum; type=mRNA; length=219bp; location=Sequence derived from: Ca3:26929923..26930141- (Cicer arietinumATGGCTTCACTGATACTTCTGTTTTCAGAACTTGTTTGGAATCAAGAGTG
GGATTCTACAGCTCTATTAGCCACTAACATTAATGCTACTGCTACATTGA
AAGATCGTGTGCGTGACATTCAAAAGCAGAACACCCTGCACAAAAGTTCT
CTAGAAGCGGTGAACTTCGCTGATAATCCATTGGAATCGAGGGTGTGTGT
CGATTTTGTTTGGCCTTGA back to top Coding sequence (CDS) from alignment at Ca3:26929923..26930141-
>Ca_08213_v1.0_kabuli ID=Ca_08213_v1.0_kabuli; Name=Ca_08213; organism=Cicer arietinum; type=CDS; length=219bp; location=Sequence derived from: Ca3:26929923..26930141- (Cicer arietinum back to top
