LG004, LG004 (genetic_marker) Vicia faba | PulseDB

Marker Overview

Marker Overview


Name	LG004
Genbank ID	TC208087
Type	Indel
Species	Vicia faba
Primer 1	LG004.Forward primer: CGAGGAAACGTTGCAGGTGG
Primer 2	LG004.Reverse Primer: CGTGAAGGGTTTGGCCAAGGC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	TC208087

Publications


Year	Publication
2008	Ellwood SR, Phan HT, Jordan M, Hane J, Torres AM, Avila CM, Cruz-Izquierdo S, Oliver RP. Construction of a comparative genetic map in faba bean (Vicia faba L.); conservation of genome structure with Lens culinaris. BMC genomics. 2008; 9:380.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	faba-ConsensusMap_2013-RIL	LGIV	N/A	146.43	LG4	View
2	Faba-Vf6/Vf27-RIL	LG04	N/A	440.4	LG4	View
3	Faba-Vf6/Vf27-RIL-2021	LG04	N/A	427.4	LG4	View
4	Faba-Vf6/Vf27-F8-F9	LGIV	N/A	448.97	LG4	View