|
Marker Overview
Name | CLM-0005 |
Genbank ID | N/A |
Type | SSR |
Species | Vigna unguiculata |
Primer 1 | CLM-0005.Forward: TCACAAGACGCACAAAACAC |
Primer 2 | CLM-0005.Reverse: AGATCGGAGAATGAACGATG |
Publication | [view all] |
Contact | Guojing Li
|
Alignments
The following features are aligned
Publications
Year | Publication |
2011 | Xu P, Wu X, Wang B, Liu Y, Ehlers JD, Close TJ, Roberts PA, Diop NN, Qin D, Hu T, Lu Z, Li G. A SNP and SSR based genetic map of asparagus bean (Vigna. unguiculata ssp. sesquipedialis) and comparison with the broader species. PloS one. 2011 Jan 06; 6(1):e15952. |
|