PsCam023300

Marker Overview
NamePsCam023300
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam023300
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGTTCTAGGAGAAATATTGGTTCATATATTGCTTACAATTTGATTCACATTTTCCCTTAC
3' Flanking SequenceGATAGTGGGAATTTCCCTGCATAGTATTAGAAGAATGTCAGAATAGGTAGGAGTAATTTA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam023300_13154_1928PsCam023300_13154_1928Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Ballet_x_Cameor-RILLG01N/A7.6PsCam023300_13154_1928View
2Pea-Cerise_x_Cameor-F3LG01N/A10.1PsCam023300_13154_1928View
3Pea-Champagne_x_Terese-RILLG01N/A13.8PsCam023300_13154_1928View
4Pea-China_x_Cameor-RILLG01N/A8.1PsCam023300_13154_1928View
5Pea-Consensus_GenoPea_array-2015LG01N/A12PsCam023300_13154_1928View
6Pea-JI296_x_DP-RILLG01N/A9.8PsCam023300_13154_1928View
7Pea-Kazar_x_Cameor-RILLG01N/A6.4PsCam023300_13154_1928View
8Pea-Kazar_x_Melrose-RILLG01N/A3.4PsCam023300_13154_1928View
9Pea-Sommette_x_Cameor-RILLG01N/A18.6PsCam023300_13154_1928View
10Pea-VavD265_x_Cameor-RILLG01N/A12.2PsCam023300_13154_1928View
11Pea-002067/Reward-F8-RILLG01N/A170.93PsCam023300_13154_1928View
Sequence
>PsCam023300 ID=PsCam023300|Name=PsCam023300|organism=Pisum sativum|type=genetic_marker|length=121bp
TGTTCTAGGAGAAATATTGGTTCATATATTGCTTACAATTTGATTCACAT
TTTCCCTTACYGATAGTGGGAATTTCCCTGCATAGTATTAGAAGAATGTC
AGAATAGGTAGGAGTAATTTA