PsCam025690

Marker Overview
NamePsCam025690
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam025690
TypeSNP
SNP AllelesT/C
5' Flanking SequenceCTCGCCAAGAGTTTCTGAGATAGGAAGAGTTGAAGGCCAACTAGCTAAAATATTTACGCC
3' Flanking SequenceGGAGCAGTTAAATCGGGCTACAATATTAAACAAAAGAAAAGTGAGCTACAAGTATTGTAA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam025690_14755_919PsCam025690_14755_919Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Baccara_x_PI180693-RILLG01N/A3.9PsCam025690_14755_919View
2Pea-Ballet_x_Cameor-RILLG01N/A23.7PsCam025690_14755_919View
3Pea-Cameor_x_Melrose-RILLG01N/A27.3PsCam025690_14755_919View
4Pea-Cerise_x_Cameor-F3LG01N/A17.1PsCam025690_14755_919View
5Pea-China_x_Cameor-RILLG01N/A30.6PsCam025690_14755_919View
6Pea-Consensus_GenoPea_array-2015LG01N/A26.1PsCam025690_14755_919View
7Pea-Kazar_x_Cameor-RILLG01N/A18.6PsCam025690_14755_919View
8Pea-Kazar_x_Melrose-RILLG01N/A13.5PsCam025690_14755_919View
9Pea-Sommette_x_Cameor-RILLG01N/A30.9PsCam025690_14755_919View
10Pea-VavD265_x_Ballet-RILLG01N/A22.4PsCam025690_14755_919View
Sequence
>PsCam025690 ID=PsCam025690|Name=PsCam025690|organism=Pisum sativum|type=genetic_marker|length=121bp
CTCGCCAAGAGTTTCTGAGATAGGAAGAGTTGAAGGCCAACTAGCTAAAA
TATTTACGCCYGGAGCAGTTAAATCGGGCTACAATATTAAACAAAAGAAA
AGTGAGCTACAAGTATTGTAA