PsCam043012

Marker Overview
NamePsCam043012
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam043012
TypeSNP
SNP AllelesT/C
5' Flanking SequenceATAATGAAGAGAAATGGAAAATGGGAAGAAATTTACCTGACCAAAATCAATGGCGAGTTT
3' Flanking SequenceTGAAGGTCGTTCTCGGATAAGCCAAGGAGAACCTGAGACGGAGGAGTTGTAGGAGGGGAA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam043012_27046_517PsCam043012_27046_517Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Ballet_x_Cameor-RILLG01N/A28.4PsCam043012_27046_517View
2Pea-Cameor_x_Melrose-RILLG01N/A29.5PsCam043012_27046_517View
3Pea-Cerise_x_Cameor-F3LG01N/A18.1PsCam043012_27046_517View
4Pea-Champagne_x_Terese-RILLG01N/A29PsCam043012_27046_517View
5Pea-China_x_Cameor-RILLG01N/A32.4PsCam043012_27046_517View
6Pea-Consensus_GenoPea_array-2015LG01N/A28.6PsCam043012_27046_517View
7Pea-JI296_x_DP-RILLG01N/A24PsCam043012_27046_517View
8Pea-Kazar_x_Melrose-RILLG01N/A13.9PsCam043012_27046_517View
9Pea-VavD265_x_Ballet-RILLG01N/A24.2PsCam043012_27046_517View
Sequence
>PsCam043012 ID=PsCam043012|Name=PsCam043012|organism=Pisum sativum|type=genetic_marker|length=121bp
ATAATGAAGAGAAATGGAAAATGGGAAGAAATTTACCTGACCAAAATCAA
TGGCGAGTTTYTGAAGGTCGTTCTCGGATAAGCCAAGGAGAACCTGAGAC
GGAGGAGTTGTAGGAGGGGAA