PsCam049560

Marker Overview
NamePsCam049560
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam049560
TypeSNP
SNP AllelesT/C
5' Flanking SequenceTGAGGTTGTCATCACTTGAATCAGAAGATTCTAATCCCATCTTCAAATCAAAAATATTTC
3' Flanking SequenceTGGGATGAGACTCTATATGATTCATATAGATTATATATATACAATTATTGTTCAATGTGT
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam049560_32187_2924PsCam049560_32187_2924Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Ballet_x_Cameor-RILLG01N/A1.4PsCam049560_32187_2924View
2Pea-Cerise_x_Cameor-F3LG01N/A2.4PsCam049560_32187_2924View
3Pea-Champagne_x_Terese-RILLG01N/A2.3PsCam049560_32187_2924View
4Pea-China_x_Cameor-RILLG01N/A2.2PsCam049560_32187_2924View
5Pea-Consensus_GenoPea_array-2015LG01N/A3.4PsCam049560_32187_2924View
6Pea-VavD265_x_Ballet-RILLG01N/A1.7PsCam049560_32187_2924View
Sequence
>PsCam049560 ID=PsCam049560|Name=PsCam049560|organism=Pisum sativum|type=genetic_marker|length=121bp
TGAGGTTGTCATCACTTGAATCAGAAGATTCTAATCCCATCTTCAAATCA
AAAATATTTCYTGGGATGAGACTCTATATGATTCATATAGATTATATATA
TACAATTATTGTTCAATGTGT