PsCam055999

Marker Overview
NamePsCam055999
dbSNP IDN/A
SNP Array ID
GenoPea_13.2K:PsCam055999
TypeSNP
SNP AllelesA/G
5' Flanking SequenceTACATCACATTTTGTTATACTAGGAAAAGAACATGTTTGATGAGGTTTTTTGGATGAAAG
3' Flanking SequenceTACTCAAAGTTAAGACCAAAGGTTTTCATTTTTCTTGCAGCTCTATAGAATGAGTTTGCA
SpeciesPisum sativum
Publication[view all]
ContactNadim Tayeh
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsCam055999_36890_2366PsCam055999_36890_2366Pisum sativummarker_locus


Contact
NameDetails
Nadim Tayeh
First name:Nadim
Last name:Tayeh
Institution:INRA
Address:Dijon
Country:France
Email:nadim.tayeh@dijon.inra.fr
Last update:Nov 2015
Libraries
Library NameType
GenoPea_13.2KSNP_chip
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Pea-Ballet_x_Cameor-RILLG01N/A6.2PsCam055999_36890_2366View
2Pea-Cameor_x_Melrose-RILLG01N/A11.9PsCam055999_36890_2366View
3Pea-Cerise_x_Cameor-F3LG01N/A10.1PsCam055999_36890_2366View
4Pea-China_x_Cameor-RILLG01N/A6.9PsCam055999_36890_2366View
5Pea-Consensus_GenoPea_array-2015LG01N/A10.5PsCam055999_36890_2366View
6Pea-Kazar_x_Melrose-RILLG01N/A2.5PsCam055999_36890_2366View
7Pea-VavD265_x_Cameor-RILLG01N/A10.4PsCam055999_36890_2366View
8Pea-002067/Reward-F8-RILLG01N/A168.02PsCam055999_36890_2366View
Sequence
>PsCam055999 ID=PsCam055999|Name=PsCam055999|organism=Pisum sativum|type=genetic_marker|length=121bp
TACATCACATTTTGTTATACTAGGAAAAGAACATGTTTGATGAGGTTTTT
TGGATGAAAGRTACTCAAAGTTAAGACCAAAGGTTTTCATTTTTCTTGCA
GCTCTATAGAATGAGTTTGCA